Cristina R. David

 

Home | Philosophy | Credentials | Letters of Recommendation | Evaluations | Sample Lessons

Native American Week | Technology | Master's Research  | Teaching Resources

 

Printable Version

Who Stole Mrs. Pontius's Gel Pen:

Introduction and Instructions

 

Introduction

In this simulation, you will examine crime scene evidence to determine who is responsible for a theft in the classroom.  You will model the process of gel electrophoresis and DNA fingerprinting. 

 

Incident type: Theft

Property stolen: gel pen

Owner’s name: Mrs. Pontius

Value: Priceless

 

Narrative

A statement from Mrs. Pontius revealed that the stolen item was not just any gel pen, it was her favorite red gel pen that she used to grade her very first test as a teacher (Yes, it still works).  She claims that it has great sentimental value to her.  She found that the pen was missing from her desk this morning.  Officers dusted the crime scene (the classroom) for fingerprints and found hundreds of student fingerprints on or near Mrs. Pontius’s desk.  The custodians were questioned and they do not remember seeing the gel pen when they cleaned the room.  However, they did find a strange note (pictured below) in a sealed envelope.  Our lab technician revealed that the perpetrator licked the envelope to seal it and thus left a saliva sample. 

 

IF  YOU  WAN T  TO  SEE    YOUR   PRECIOUS  GEL   PEN  AGAIN,   LEAVE  $500  IN  THE   BACK   ROOM   BY  3:00  T ODAY . . .  OR  ELSE!

 

The Suspects

 

Suspect number: 1

Name: ______________________

Description of Suspicion: Witnesses saw this suspect arguing with Mrs. Pontius over a test grade, yesterday at 2:00 pm.  The suspect allegedly wanted two more points so that the test grade would be a “100” instead of a “98”.  Witnesses say that Mrs. Pontius could not find any way to add two more points to the test.

 

Suspect number: 2

Name: ______________________

Description of Suspicion:  Other students in the class said that they saw this suspect using a red pen in class yesterday.  They found this unusual because they said that this suspect usually never brings a pen or a pencil to class.

  

Suspect number: 3

Name: ______________________

Description of Suspicion:  This suspect was also seen arguing with Mrs. Pontius.  The argument took place at 2:30 pm yesterday.  The suspect alleged that Mrs. Pontius had lost the suspect’s lab folder.  The suspect said that there were three completed labs in the folder that would now have to be completely redone. 

 

Suspect number 4:

Name: ______________________

Description of Suspicion:  Witnesses saw this suspect “lurking” around Mrs. Pontius’s desk yesterday morning.  When questioned, the suspect stated that he/she was simply looking for a misplaced workbook. 

 

Suspect number 5:

Name: ______________________

Description of Suspicion:  Background checks on all of Mrs. Pontius’s students revealed that this suspect had quite a “rap sheet”.  Some of the suspect’s priors: caught jaywalking in 2004, sneaking out of the house after curfew in 2005, and skipping detention in 2006. 

 

Crime Lab Data

 

Evidence received:        envelope with saliva sample

Procedures used:          DNA extraction, Polymerase Chain Reaction, DNA restriction Analysis

 

DNA was first extracted from saliva on the envelope seal.  Because the sample was so small, polymerase chain reaction was used to amplify the DNA.  The DNA was also isolated from the five suspects and were compared to the crime scene DNA using DNA restriction analysis or “DNA fingerprinting”

DNA Fingerprinting Procedure

1. The restriction enzyme cuts the DNA sequence at every point it finds C C G G, always cutting between the C and the G.  First mark the places where you will be cutting the DNA sequence at the  C C G G points.  Use scissors to cut the DNA sequence (on previous page) at the C C G G points.  Cut through all three rows, leaving the “identity line” with the fragments so that you don’t get them confused after cutting.  For example:

 

Suspect 1 DNA Susp     ect 1 DNA Sus

GTAGCTGCGCC   GGGTAACC

CATCGACGCGG   CCCATTGG

 

2. Count the number of base pairs (bp) in each piece of DNA that you created. Record the base pair number on the back side of the DNA fragment.

3. Tape your DNA fragments to the chart, using the base pair numbers as a guideline for fragment placement.

5. Compare the crime scene DNA and answer the analysis questions on the back of your chart. 

 

The DNA sequences:

 

Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Sc

GTCGATCCGGTGCCGTGCCGGCACAGTGCTCCGGATAGCTGATAGCTCCGGTG

CAGCTAGGCCACGGCACGGCCGTGTCACGAGGCCTATCGACTATCGAGGCCAC

 

 

Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Suspect 1 DNA Susp

GTCCCAGCCGGACCGATTACCGGTTAGATCGAGCCGGTAGATAGCGTGATGTG

CAGGGTCGGCCTGGCTAATGGCCAATCTAGCTCGGCCATCTATCGVACTACAC

 

Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Suspect 2 DNA Susp

GTTCCGGACGCCTCCGGAATCGTAGCCACCGGTCCCCGGACAGTACTGTGGTG

CAAGGCCTGCGGAGGCCTTAGCATCGGTGGCCATGGGCCTGTCATGACACCAC

 

Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Susp

GTCGATCCGGTGCCGTGCCGGCACAGTGCTCCGGATAGCTGATAGCTCCGGTG

CAGCTAGGCCACGGCACGGCCGTGTCACGAGGCCTATCGACTATCGAGGCCAC

 

Suspect 4 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Suspect 3 DNA Susp

GTCTCCATCCGGACTACTCATGTGTACCCGGTGATATCTCATAGTCCGGAGTG

CAGAGGTAGGCCTGATGAGTACACATGGGCCACTATAGAGTATCAGGCCTCAC

 

Suspect 5 DNA Suspect 5 DNA Suspect 5 DNA Suspect 5 DNA Suspect 5 DNA Suspect 5 DNA Susp

GTCCCAGCCGGCATCCGGACAGTGTACACATGCTCCGGCTATACGACCGGGTG

CAGGGTCGGCCGTAGGCCTGTCACATGTGTACGAGGCCGATATGCTGGCCCAC

 

 

 

Scoring Guide

The following points will be assigned for each portion of this activity

1.  Stayed on task                                                                              20 points

Student was working on the activity and exhibited

proper behavior (e.g., no throwing of supplies) during

the entire class period

 

2.  Completed Gel Electrophoresis                                                   40 points

Each student must hand in a completed chart

(gel electrophoresis) with all of the DNA fragments

pasted onto it.

                       

3.  Completed Analysis Questions                                                    40 points

Each students must hand in the completed answers

to the 8 analysis questions that are located on the

back of their chart.  Each question is worth 5 points. 

 

 

ANALYSIS QUESTIONS:

1. On your chart, label the positive (+) and the negative (-) ends.

2.  Circle the suspect's DNA who matches the DNA at the crime scene and write the name of the suspect at the bottom of the chart.

3.  When you cut the DNA into fragments, what were you actually simulating?  In other words, in real DNA fingerprinting, what does the cutting of the DNA segments?

 

4.  When you taped the DNA onto the chart, what process is this actually simulating?

 

5.  In gel electrophoresis, why do the DNA fragments move towards the positive end?

 

6.  In gel electrophoresis, what type of fragments move the farthest from the wells (at the top of the chart)?

 

7.  Explain how polymerase chain reaction is useful for DNA fingerprinting. 

 

8.  Below is an actual gel electrophoresis of some DNA fingerprints.  Who is likely to be the guilty suspect?

Text Box: #3

 

Text Box: #2

 

Text Box: #1

 

 

 

 

Site maintained by Cristina R. David

Last updated May 17, 2007